What makes you different from everyone else

Different medical issues. As I've mentioned before, I have not heard a day of silence in 45 years. I have three different ear tones in each ear. And then of course my problems with my back.

DNA 🧬

My suffering and im not afraid of it .
You get closer to God with suffering but the key with good suffering is incredible .
The key is to make amends to people cause if not and your suffering would be too much if you don't make amends to people .
You be wasting your life away suffering if you don't make amends too people

The bit in my dna where it goes ggccgcgtaggatctcagacccaaattcctcga

I don’t know 🤷🏻‍♀️ I’m not everyone else

My experiences.

DNA

My family.

I'm not different from everyone else, but still different from many.
I am too old fashioned... but not perfect! lol
I don't wish to show off on internet... won't share my own pictures or those of family and friends.
I'm content to just be.... I don't need to impress others nor do I care to try.
I'd say it would be easier for someone else who knows me to give a great answer to this.