Asking
Only logged in members can reply and interact with the post.
Join SimilarWorlds for FREE »

What makes you different from everyone else

This page is a permanent link to the reply below and its nested replies. See all post replies »
KingofPizza2 · 41-45, M
The bit in my dna where it goes ggccgcgtaggatctcagacccaaattcctcga