I Have a Question
Asking
No Notifications
Only logged in members can reply and interact with the post.
Join SimilarWorlds for FREE »

What makes you different from everyone else

Kiaralewis
31-35, F
9 replies 42 views Sep 1, 2022
Share Link
This page is a permanent link to the reply below and its nested replies. See all post replies »
KingofPizza2 · 36-40, M
The bit in my dna where it goes ggccgcgtaggatctcagacccaaattcctcga
+ 0 · Reply · Translate · Sep 1, 2022