Science
Only logged in members can reply and interact with the post.
Join Similar Worlds today ยป

Genetics Assignment Question

How can I change phenylalanine to leucine using site directed mutagenesis, by using given DNA sequence 5' ATGGGATTGGGGTTTTCCCCTCCC3'

The primers must be included in asnwer

 
Post Comment
 
20 people following
Science
Personal Stories, Advice, and Support
New Post
Category Members